Each cell of your body has a copy of the instructions that are used by the cell to maintain and duplicate itself. These instructions (the DNA) are in a single string of only four chemical compounds that are represented by the letters A, C, T, and G. The length of this string - the code - to define an entire human being - is necessarily very long. The human code has 3.165 billion letters. In letter shorthand it looks like:

    GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT

and so on for 52.75 million lines.

Half of this code comes from your mother, and half from your father, with two exceptions. One exception (only if you are male) is a section of 51 million letters that came only from your father. These are the instructions that make a male different from a female (the y-dna). The other exception is a string of separate DNA 16,568 letters long (the mtdna). Both males and females have this mtdna, which only comes from their mother.

mtdna results

It is possible, using chemical tests, to 'read' the entire 16,568 letters of mtdna code. But it is still very expensive. So, depending how much you paid, only a few hundred of the letter sequence were read. Your mtdna result looks something like this:

HVR1 (the basic test): 16209C, 16223T, 16255A, 16292T, 16519C
HVR2 (the extra test): : 73G, 119C, 189G, 195C, 204C, 207A, 263G, 309.1C, 315.1C

HVR1 and HVR2 are the names of sections of that 16,568 mtdna string of letters. The HVR1 section goes from letter 16001 to letter 16569. HVR2 runs from letter 1 to letter 574. Your mtdna code in those sections has been tested completely. However rather than list hundreds of letters, only the differences from a standard letter sequence are shown (the standard sequence is called the Cambridge Reference Sequence, or CRS). So the result above means that where letter 16209 in the CRS was a T, you have a C. Where letter 16223 in the CRS was a C, you have a T. And so on.

Where a number like 309.1 or 309-1 appears, this means that an extra letter was inserted at that position, compared to the CRS code.

One point of confusion - the CRS is not the code of 'Eve'. Your results are not the changes that you have compared to the maternal ancestor of us all. They are instead the differences between your code and that of a lady who happened to be sequenced in Cambridge, England, in the 1990's. She was actually a member of haplogroup H, the most common in Europe.