What do those letters and numbers mean?

Each cell of your body has a copy of the instructions that are used by the cell to maintain and duplicate itself. These instructions (the DNA) are in a single string of only four chemical compounds that are represented by the letters A, C, T, and G. The length of this string - the code - to define an entire human being - is necessarily very long. The human code has 3.165 billion letters. In letter shorthand it looks like:

    GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCT

and so on for 52.75 million lines.

Half of this code comes from your mother, and half from your father, with two exceptions. One exception (only if you are male) is a section of 51 million letters that came only from your father. These are the instructions that make a male different from a female (the y-DNA). The other exception is a string of separate DNA 16,568 letters long (the mtdna). Both males and females have this mtdna, which only comes from their mother.

MTDNA Results

It is possible, using chemical tests, to 'read' the entire 16,568 letters of mtdna code (a Full Genetic Sequence, or FGS). But it is still a bit expensive. So, depending how much you paid, only a few hundred of the letter sequence may have been read. Your mtdna result looks something like this:

HVR1 and HVR2 are the names of sections of that 16,568 mtdna string of letters. The HVR1 section goes from letter 16001 to letter 16569. HVR2 runs from letter 1 to letter 574. The CR runs from letter 575 to 16000. Your mtdna code, in the sections you paid for, has been tested completely. However rather than list hundreds of letters, only the differences from a standard letter sequence are shown (this standard sequence is called the Cambridge Reference Sequence, or CRS). So the result above means that where letter 73 in the CRS was an A, you have a G. Where letter 16223 in the CRS was a C, you have a T. (normally C's change to T's and vice versa, and A's to G's and vice-versa - but there are, less often, other possibilities.

Where a number like 309.1 or 309-1 appears, this means that an extra letter was inserted at that position, compared to the CRS code.

One point of confusion - the Cambridge Reference Sequence is not the code of 'Eve'. Your results are not the changes that you have compared to the maternal ancestor of us all. They are instead the differences between your code and that of a lady who happened to be sequenced in Cambridge, England, in the 1990's. She was actually a member of haplogroup H, the most common in Europe.

Comments? Corrections? Questions? E-mail me!